Content area
Abstract
Background
Peroxisome proliferator-activated receptor-gamma coactivator-1beta (PGC-1β) is a transcriptional coactivator that plays important roles in regulating multiple aspects of energy metabolism and cytokine signaling pathways. We have reported that down-regulating PGC-1β alleviated the proinflammatory effect of rheumatoid arthritis (RA) fibroblast-like synoviocytes (FLS). Recent study reported that osteoclast formation and bone resorption were markedly suppressed in PGC-1β knockout mice. However, the role of PGC-1β on the osteoclastogenesis in RA has not yet been illuminated.
Objectives
To investigate the effect and underlying mechanism of PGC-1β on RA-FLS induced osteoclastogenesis and bone resorption
Methods
Synovium was obtained from 3 active RA patients and cultured RA-FLS was identified by flow cytometry using CD55 antibody. RAW264.7, used as precursor of osteoclast, was cocultured with RA-FLS or human RANKL. Gene knockdown was performed by lentivirus short hairpin RNAs (sh-RNAs) which were cloned into pLKO.1 (GV248) lentiviral vectors. The sh-PGC-1β targeting sequence was GGAGGAGGAAGAAGAAGAATT, while sh-GFP was regarded as negative control. Culture supernatants containing sh-RNA were added to RAW264.7 in the presence of polybrene. Stable cell lines were validated by western blot. RAW264.7 transfected with sh-PGC-1β or sh-GFP was cocultured with RA-FLS in 6 well-plates with transwell plates. At day 14, osteoclasts were identified as multinucleated cells that contained >3 nuclei with positive staining of tartrate-resistant acid phosphatase (TRAP), and protein of RAW264.7 and osteoclasts was extracted for western blot determining the phosphorylation of ERK, JNK, p38 and NF-κB. At day 21, resorption lacunae area was identified by toluidine blue staining and measured by image analysis system.
Results
(1) Flow cytometry results showed the purity of cultured FLS was over 90%. TRAP staining showed osteoclast formation in both cocultrue system of RAW264.7 with RA-FLS or human RANKL.
(2) The protein expression of PGC-1β in RAW264.7 transfected with sh-PGC-1β was hardly detected compared with negative control ( Fig. 1C ). At day 14, down-regulating PGC-1β of RAW264.7 cells could significantly decrease the number of osteoclasts compared with negative control [(1037±356) vs (237±110) per well, P=0.021, Fig. 1A ]. At day 21, down-regulating PGC-1β of RAW264.7 cells could significantly inhibit the resorption lacunae area on bone slices compared with negative control [(25.33±6.50) % vs (10.67±5.51) %, P=0.041, Fig.1B ].
(3) The protein expression of p-NF-κB from RAW264.7 and osteoclasts was significantly down-regulated in sh-PGC-1β transfected group than sh-GFP transfected group, but not p-ERK, p-JNK or p-p38 ( Fig. 1C ).
Conclusions
Our results implied that down-regulated PGC-1β could inhibit RA-FLS induced osteoclastogenesis and bone resorption by suppression of NF-κB activation.
Acknowledgements
Supported by Grant support was provided: National Natural Science Foundation of China (81471597), Specialized Research Fund for the Doctoral Program of Higher Education (20130171110075) and Guangdong Natural Science Foundation (S2013010014396).
Disclosure of Interest
None declared