1. Introduction
Japanese encephalitis virus (JEV), a member of the genus Flavivirus, is one of the smallest viruses in the Flaviviridae. The JEV virion is spherical, with an icosahedral symmetry of approximately 40 to 50 nm in diameter, and has a single-stranded RNA molecule of approximately 11 kb, making it a positive-stranded RNA virus with an envelope. The Flavivirus genome contains a single open reading frame (ORF) that encodes a polyprotein. This polyprotein encodes three structural proteins, which are encoded in the 5′ third of the ORF sequences: the capsid (C), pre-membrane/membrane (prM/M), and envelope (E) proteins. Seven non-structural (NS) proteins (NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5) are encoded in the remaining 3′ two-thirds sequences. The E protein is considered to be the most important immunogen [1,2,3,4,5]. JEV can cause serious infectious disease symptoms in humans and spread worldwide [6]. Many animals infected with JEV can become the source of transmission, of which pigs are the important host, the most important source of infection, and the amplifying host of the disease. JEV circulates in “mosquito-pig-mosquito” and “porcine-mosquito-human” cycles [7,8,9]. JEV can cause encephalitis in piglets, retention heat in fattening pigs, sow abortion, and male orchitis in pigs, which has caused huge economic losses to the pig industry [1]. JEV can cause irreversible damage in infected humans, manifesting symptoms such as high fever, impaired consciousness, convulsions, and even leading to mental retardation, aphasia, and ankylosis of hands and feet [3,10,11].
The pathogen was first found in Japan in 1934, and JEV was also isolated in China in 1939. At present, the disease is prevalent throughout Asia, mainly in tropical, subtropical, and temperate countries in eastern Asia, of which Asia includes China, Japan, India, Malaysia, Vietnam, and other countries as the main epidemic areas of JE [12,13,14]. In the tropical and subtropical regions of Asia, the virus is mainly transmitted through Culex mosquitoes [8,15]. JEV’s high mortality and disability rates make it a public health priority in Asian countries. The spread of JEV is highly dynamic; its spread and outbreak patterns are affected by fluctuating environmental and social factors [4,16,17]. Clinically, different hosts infected with JEV exhibit different clinical symptoms. Most human infections are asymptomatic, but children and the elderly may develop mild infections, which in severe cases lead to encephalitis. The incubation period of the disease is 4–15 days, and patients with JE may show nonspecific initial symptoms such as fever, headache, nausea, diarrhea, vomiting, and myalgia. These may be followed by acute encephalitis with neurological symptoms [18]. Pigs are one of the most susceptible animals to JEV, and pigs can show typical clinical signs after infection with JEV [19,20]. Piglets infected with JEV show obvious signs of encephalitis, pregnant sows infected with JEV develop abortions and stillbirths, and testicular inflammation occurs in boars [21]. Pathological changes caused by JEV are mainly manifested in tissues and organs such as the brain, spinal cord, testes, and uterus, where obvious meningeal and cerebral vascular congestion, hemorrhage, and edema, as well as substantial foci of testicular congestion and necrosis, can be seen [22]. Aborted fetuses may commonly present with cerebral edema, increased ascites with subcutaneous hemorrhagic infiltration, and varying fetal size, with some presenting as mummified fetuses. At present, there is no specific drug for the treatment of JE, prevention is the mainstay of the breeding industry, and the treatment of JE is not advocated. However, disease prevention for humans and livestock can be achieved through health measures and vaccination. In addition, as a natural focus disease transmitted by mosquitoes, the incidence of JE will be affected by climate factors such as temperature and rainfall [2,23,24,25].
Previous research on JEV has mostly focused on human sources, and relatively few studies have been conducted on mosquito-derived viruses and pig-derived JEVs. This paper can grasp the changes in different subtypes in Fujian. Therefore, research on the local pigpens seasonal population of mosquitoes, the JEV genotype, and natural JEV transmission is important for understanding the transmission and spread of JEV. Fujian has a subtropical monsoon climate. Influenced by monsoon circulation and topography, it is warm and humid with abundant rainfall. In history, Fujian was a province with a high incidence of JE. After the comprehensive use of the JE vaccine in the 1980s, the epidemic was brought under control [26]. However, vaccines are expensive and require multiple doses to maintain efficacy and immunity. Although Japanese encephalitis (JE) has been decreasing in severity in mainland China, it remains a serious swine infectious disease. Therefore, monitoring and controlling major mosquito vectors is a more promising strategy to reduce transmission, and it is very important to establish continuous and effective detection and early warning mechanisms. On the one hand, we need to monitor the molecular genetic variation characteristics of JEV to prevent new epidemics of JEV. On the other hand, it is necessary to monitor mosquito vectors in pig farms. JEV has the characteristic of insect vector transmission, especially in the mosquito breeding season. In order to further grasp the basic background of JEV in pig farms in Fujian Province, this study carried out nucleic acid detection of JEV from mosquito samples collected at four monitoring points in Fujian Province from July to September 2019 and determined the molecular characteristics of JEV strains in pig farms in Fujian Province through the E gene sequence analysis.
2. Materials and Methods
2.1. Mosquito and Swine Blood Sample Collection
Mosquitoes were trapped daily using black ultraviolet (UV)-light traps (12 V, 300 mA; Photocatalytic Technology Mosquito Catcher Device, Electrical Technology, Guangdong, China) at Fuqing (FQ)-YC, Sanming (SM)-YS, Nanping (NP)-YR, and Nanping(NP)-LTS (Figure S1, Table S1) in Fujian Province from late July to early September (local mosquito activity season) in 2019. Six black UV-light traps were set for each farm: three placed in different barns and three under the eaves outside [27]. The collected mosquitoes were frozen at −20 °C and male mosquitoes were removed from the samples. The specimens were classified and divided according to different mosquito species. Fifty mosquitoes were pooled, labeled, and stored in liquid nitrogen. A total of 120 sera from pigs at 3 months of age were collected from Fuqing-YC, Sanming-YS, Nanping (NP)-YR, and Nanping-LTS, and 30 serum samples were obtained from each farm.
2.2. JEV Detection and Virus Isolation
After subdividing the collected mosquitoes for grinding, total RNA was extracted from the original biological samples and pig blood using Trizol (Takara Bio, Kusatsu, Japan). The cDNA libraries were prepared using the M-MLV (H-) Reverse Transcriptase kit (Vazyme Biotech Co., Ltd., Piscataway, NJ, USA) following the operating instructions. The JEV E gene sequence was amplified using JEV-E-F1 and JEV-E-R1 primers designed in this laboratory (Table 1). PCR-positive samples were sent to Sangon Biotech (Shanghai, China) Co., Ltd. (No. 698, Xiangmin Road, Songjiang District, Shanghai, China) for sequencing using JEV-E-F2 and JEV-E-R2.
Baby hamster kidney (BHK)-21 cells were cultured in 93% Dulbecco’s modified Eagle’s medium supplemented with 7% heat-inactivated fetal bovine serum (FBS; Invitrogen) and 100 U/mL of penicillin and streptomycin. The mosquito pools (50 mosquitoes/pool) were triturated in minimum essential medium (containing 1% FBS, 100 U/mL of penicillin, 100 U/mL of streptomycin, and lL/mL of fungizone) using the TissueLyser (Qiagen, Valencia, CA, USA) at room temperature for 3 min. The homogenates were clarified by centrifugation at 12,000 rpm and 4 °C for 10 min. Clarified homogenates (100 µL) were inoculated onto monolayers of BHK-21 cells for 1 h at 37 °C, respectively. Then, the cells were washed with minimum essential medium and were maintained at 37 °C adding the minimum essential medium containing 5% FBS, 100 U/mL of penicillin, 100 lg/mL of streptomycin, and 1 lL/mL of fungizone [28]. Cells were observed daily for cytopathic effects (CPEs) from days 1–7 postinfection. All experiments for the virus isolation were performed in a biosafety level 2 cell culture laboratory established at Shanghai Veterinary Research Institute, China.
2.3. JEV E Gene Sequence Analysis
The nucleotide sequence of the E gene of a classical JEV strain was searched from GenBank. The evolutionary relationships of E genes were compared with 45 references of JEV in GenBank from different decades, countries, and hosts (Table 2). Multiple sequence alignments and sequence similarity calculations between aligned nucleotide and amino acid sequences were performed using DNASTAR software (Madison, WI, USA) [29]. Multiple sequence alignments and phylogenetic trees were produced using MEGA 6.0 software and constructed from aligned nucleotide sequences using the neighbor-joining method. The stability of the tree obtained was established by bootstrapping analysis with 1000 replications [30].
Minimum infection rate (MIR): The MIR (number of positive pools/total specimens tested ×1000) was calculated for each mosquito species and virus collected over the duration of the project. The MIR is expressed as the number of positive mosquitoes per 1000 tested and assumes that a positive pool contains only 1 infected mosquito.
3. Results
3.1. Identification of Mosquitoes
A total of 19,177 mosquito specimens representing seven species from four genera (14,651 Culex tritaeniorhynchus (76.40%), 38 Culex bitaeniorhynchus (0.2%), 3691 Anopheles sinensis (19.25%), 55 Culex pipiens pallens (0.29%), 645 Aedes vexans (3.36%), and 97 Armigeres subbalbeatus (0.51%)) were collected from July to September in 2019 (Table 3). Culex mosquito was the dominant species, with 14,744 mosquitoes, accounting for 76.89% of the total mosquito collection. The collected specimens were preserved at −20 °C.
3.2. JEV Detection and Gene Sequencing
Five E gene sequences obtained from the mosquitoes and pigs were 1500 nt long, respectively, and have been deposited in GenBank (acc. no. FJ1901, FJ1903, and FJ1905 for mosquito and FJ1902 and FJ1904 for pigs) (Table 4).
The 19,177 mosquitoes were sorted into 393 pools according to species, location, and date of collection. Most pools have 50 mosquitoes. Less than 50 mosquitoes also serve as a mosquito pool. In total, 6 out of 393 (1.5%) mosquito pools were PCR-positive. In addition, 8 of 120 (6%) swine blood samples were PCR-positive. All the PCR-positive samples were processed for virus isolation. A total of three isolates, FJ1901, FJ1903, and FJ1905, were obtained from mosquito samples, resulting in CPEs (Table 5). Eight PCR-positive swine blood samples were also used for virus isolation, resulting in two isolates, FJ1902 and FJ1904. Isolates FJ1901 and FJ1902 caused CPE in 2 days. CPE caused by FJ1903, FJ1904, and FJ1905 isolates began 4 days after inoculation.
3.3. Molecular Characterization and Phylogenetic Analysis Based on the E Genes of JEV
We conducted PCR using JEV-E-F2 and JEV-E-R2 primers (Table 1) to amplify the E gene of JEV from the FJ1901, FJ1902, FJ1903, FJ1904, and FJ1905 isolates and constructed a phylogenetic tree based on the sequences of the PCR products. We used 45 representative JEV strains to perform multiple sequence alignments and phylogenetic analyses (Table 2). We compared nucleotide sequences of the E gene. The homology of the Fujian 1901, Fujian 1902, Fujian 1903, Fujian 1904, and Fujian 1905 isolates, compared with the genotype I JEV strain, was 98.2–99.6%, respectively, which was higher than that for the other genotypes (88.5–88.8% and 83.1–87.4%). The Fujian isolates showed the highest homology with the classical JEV genotype I SH-53 and JEV genotype I SD0810. Phylogenetic analysis of the JEV E fragments showed that all Fujian JEV isolates were genotype I (Figure 1). The cladogram showed that isolates FJ1901 and FJ1902 were closely related to strain LN0716, strains FJ1903 and FJ1904 were closely related to strain SD0810, and strain FJ1905 was closely related to strain SH-53 (Figure 1). Our results indicated that genotype I was the major JEV subtype circulating in Fujian. In addition to the Chinese strains, we included the latest genotype I JEV strains isolated in China and Asian countries (Singapore, Japan, Korea, India, etc.) for phylogenetic analysis, and found that the newly isolated Fujian JEV strain was closely related to the latest isolates from other parts of China, as well as to the South Korean strain K05GS.
3.4. Analysis of Mutation at Critical Amino Acid Residues
Envelope protein E is a major structural protein consisting of 500 amino acids. The E protein plays an important role in JEV immunogenicity, cell fusion and infection, and viral maturation. We compared amino acid sequences of the Fujian JEV mosquito strain (FJ1901, FJ1903, and FJ1905) and pig strain (FJ1902 and FJ1904) with that of the live vaccine strain SA14-14-2 and other similar strains (Table 6). Five amino acid residues in the newly detected Fujian JEV strains differed from those in the live attenuated vaccine SA14-14-2-derived strain (SA14): E107 (Phe→Leu) E129 (Thr→Met) E138 (Lys→Glu) E176 (Val→Ile) E222 (Ala→Ser) E244 (Gly→Glu) E264 (His→Gln) E279 (Met→Lys) E315 (Val→Ala) E327 (Ser→Thr) E366 (Alal→Ser) E439 (Arg→Lys). However, some of the key sites E138, E47, E176, E123, E244, and E107 [31,32,33,34,35,36,37], which have been shown to influence virulence and antigenic activity, were unchanged compared with other genotype I JEV strains.
MIR: The MIR of JEV in Cx. Tritaeniorhynchus was 0.41/1000 (Table 7).
4. Discussion
JE can occur all year round but mainly occurs in summer or early autumn with more rain [38,39,40]. JEV is active in most Chinese provinces, and nearly 50% of the world’s reported cases occur in China [41,42,43]. Fujian is located in the subtropical region, with a mild climate, abundant rainfall, and a high density of insect vectors, and has historically been a province with a high incidence of JE epidemics in China. The main strains isolated and identified in China are JEV genotypes I, III, and V [44]. In past years, there has been a mixed epidemic of genotype I and genotype III strains, but it is still dominated by genotype III [24]. In 2010, mosquito samples were collected in Fujian Province, mainly Culex trinasis and Anopheles sinensis, and JEV genotype I was isolated from the samples [26,45]. However, the Gene Bank shows that the strains isolated in Fujian Province are mainly genotype III JEV. Detection of JEV in mosquitoes and pigs around pigpens confirmed that there is a risk of JEV infection in this area. In this study, mosquito and pig blood samples were collected from four pig farms in three regions of Fujian, and the results showed that the mosquito species were mainly Culex tritaeniorhynchus and Anopheles sinensis, which is consistent with the previous results. According to the full sequence of the E protein gene, JEV is divided into five genotypes, and the E gene is considered to be well-represented for evolutionary analysis and has become the main analysis method in recent years [46]. Therefore, in this experiment, the isolated virus was sequenced in the full sequence of the E gene and genetic evolution analysis.
We found that E gene variations indicate that the Fujian JEV strain is of type I. The sequence identities between the Fujian JEV mosquito and pig strains of the E gene were 97.2% and 99.8%, respectively, confirming the local natural JEV transmission cycle within mosquitoes and pigs. We also analyzed mutations in critical amino acid residues. Researchers compared the nucleotide sequences of JE virus strains with different virulence to elucidate the level of genes affecting the virulence of JEV [31,32,33,34,35,36,37]. There are some amino acid site differences between different genotypes of JEV, and the virulence of the virus is often affected by these differences in amino acid sites. Compared with the classical JEV genotype I SH-53 and SD0810, the JEV strain isolated in this study did not show any mutation at the above key sites in the Fujian JEV strain.
Epidemiological surveillance and ecological reports show that in some Asian countries, such as China, Japan, South Korea, Malaysia, Thailand, etc., the epidemic trend of JEV has shown genotype conversion; that is, genotype I JEV has gradually replaced GIII type as the dominant genotype of the main epidemic. In recent years, researchers have reported the isolation of genotype I JEV from mosquito samples collected in Shanghai, Henan, Tibet, and other regions [47,48,49,50,51,52]. Therefore, it is necessary to further strengthen the molecular evolution analysis and JEV isolation and detection of pig farm mosquito vectors and JEV in the insect vector concentration sites in Fujian Province and pay close attention to the transformation of the JEV genotype. It provides a theoretical basis for the prevention and control of JE in Fujian Province. The main JEV vaccine strains in common use are Nakayama, Beijing-1, Beijing-3, and SA14-14-2, all of which are JEV genotype III strains, and these vaccines do not provide complete protection against GI [53,54,55]. A comparison of sequence data revealed that the Fujian JEV mosquito/pig strains and the SA-14-14-2 vaccine differed at amino acid sites; key regions that determine antigenic activity were different. This suggests that the Fujian JEV strain’s antigenicity is different from the SA-14-14-2 vaccine strain. In theory, the currently used JEV vaccine should be ineffective in protecting against infection by the Fujian JEV strain.
The epidemiological trend of JEV in Fujian Province has shifted from genotype III to genotype I. However, the molecular mechanism of genotype switching has not been clearly explained. Some current studies suggest that the cause of genotype conversion may be related to host adaptation [56]. Xiao et al. found a host adaptation advantage of JEV genotype I over JEV genotype III in amplified hosts, especially avian hosts [29]. At the same time, Han et al. showed that JEV genotype I is more adaptive within a given host range relative to JEV genotype III [57]. That may be an important cause of genotype switching in epidemics of JEV. We analyzed nucleotide sequence variations in the E gene, indicating a relatively high degree of homology between the Fujian JEV mosquito and pig strains. On the other hand, the key E gene sites of the Fujian strain are identical to other JEV genotype I strains, and since the persistence of Flaviviruses in insects and mammals implies that it cannot withstand many variations, which suggests that JEV is genetically relatively stable.
This study reported on the vector mosquito ecology and that genotype I is now considered the dominant strain in Fujian. Monitoring changes in JEV genotypes is important for developing effective control strategies. Therefore, it will require implementing long-term continuous monitoring of JEV-infected mosquitoes and pigs, recording genotypic distribution and genetic variation in JEV, establishing strategies to control mosquito and mosquito-borne diseases, timely assessment of the transmission potential of pigs as hosts, and providing data support for Japanese encephalitis control.
Conceptualization, N.D. and J.W.; methodology, H.Z. and J.W.; software, J.Z.; validation, N.D., X.Z., J.W., and H.Z.; formal analysis, N.D. and J.W.; investigation, N.D. and J.W.; resources, Y.Q.; data curation, Z.L. and B.L.; writing—original draft preparation, N.D. and J.W.; writing—review and editing, D.S. and K.L.; visualization, J.W.; supervision, Z.M.; project administration, J.W. and Z.M.; funding acquisition, Z.M. and J.W. All authors have read and agreed to the published version of the manuscript.
Not applicable.
Not applicable.
All data are available in the main text or
The authors declare no conflict of interest.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
Figure 1. Phylogenetic tree of relationships between JEV strains based on E gene variation. Full nucleotide sequences of different JEV E genes were aligned, and evolutionary analyses were conducted in MEGA 6.0 using 1000 bootstrap replicates of the sequence data. Five viruses were isolated, FJ1901, FJ1902, FJ1903, FJ1904, and FJ1905 (indicated in red).
Primers used for RT-PCR assay to detect the E gene of JEV in mosquitoes.
| Primers | Primer Sequence (5′—′) |
|---|---|
| JEV-E-F1 | TTGGTCGCTCCGGCTTACA |
| JEV-E-R1 | GGTTTTCCGAGGTAGTGGTTC |
| JEV-E-F2 | TGCTGGTCGCTCCGGCTTA |
| JEV-E-R2 | GATGTCAATGGCACATCCAGT |
Background information on 45 JEV strains compared with Fujian JEV isolates in this study.
| Strain | Date | Region | Host | GenBank |
|---|---|---|---|---|
| FJ1901 (1) | 2019 | China, Fujian | Culex tritaeniorhynchus | OQ181396 |
| FJ1902 (1) | 2019 | China, Fujian | Swine | OQ181397 |
| FJ1903 (1) | 2019 | China, Fujian | Culex tritaeniorhynchus | OQ181398 |
| FJ1904 (1) | 2019 | China, Fujian | Swine | OQ181399 |
| FJ1905 (1) | 2019 | China, Fujian | Culex tritaeniorhynchus | OQ181400 |
| FJ08-48 | 2008 | China, Fujian | Human blood | GQ856663 |
| FJ05-139 | 2005 | China, Fujian | Human blood | GQ856661 |
| FJ05-62 | 2005 | China, Fujian | Human blood | GQ856660 |
| FJ07-51 | 2007 | China, Fujian | Human blood | GQ856662 |
| FJ08-65 | 2008 | China, Fujian | Human | GQ856664 |
| CBH | 1954 | China, Fujian | Human blood | JN381860 |
| FJ0229 | 2002 | China, Fujian | Human blood | JF706273 |
| FJ0394 | 2003 | China, Fujian | Human blood | JN381858 |
| FJ0339 | 2003 | China, Fujian | Human blood | JN381859 |
| FJ0276 | 2002 | China, Fujian | Human blood | JN381867 |
| Whe | 2006 | China | Swine | EF107523 |
| SA 14-14-2 | 2000 | China, Beijing | - | AF315119 |
| SA14 | 1954 | China | Mosquito | U14163 |
| Gz | 2010 | China | Swine | KC915016 |
| SH0601 | 2006 | China | Swine | EF543861 |
| ZMT | 1955 | China, Fujian | CSF | JN706283 |
| CAX | 2011 | China | CSF | JN381865 |
| ZSZ | 1955 | China, Fujian | CSF | JN381862 |
| YLG | 1955 | China, Fujian | CSF | JF706280 |
| SD0810 | 2008 | China, Shandong | Culex tritaeniorhynchus | JF706286 |
| SH17M-07 | 2007 | China | - | EU429297 |
| SH-53 | 2001 | China, Shanghai | Culex tritaeniorhynchus | JN381850 |
| JX61 | 2008 | China | Swine | GU556217 |
| LN0716 | 2007 | China, Liaoning | Culex tritaeniorhynchus | JN381849 |
| SH-80 | 2001 | China, Shanghai | Culex tritaeniorhynchus | JN381848 |
| JKT5441 | 1980 | Indonesia | Mosquito | JQ429306 |
| FU | 1995 | Australia | Human blood | AF217620 |
| JKT6468 | 1981 | Indonesia | Culex tritaeniorhynchus | AY184212 |
| Muar | 1952 | Malaysia | Human brain | HM596272 |
| C14-B3 | 2015 | Cambodia | Pig | KY927817 |
| Yamaguchi 804 | 2016 | Japan | Culex tritaeniorhynchus | LC461957 |
| JEV_ASSAM_03 | 2018 | India | Pig | MZ702743 |
| JEV1805M | 2018 | China | Homo sapiens | MN639770 |
| K05GS | 2005 | South Korea | Culex tritaeniorhynchus | KR908702 |
| Beijing 2020-1 | 2020 | China.Beijing | Mosquito | OP588746 |
| NIID09 | 2020 | Japan | Culex tritaeniorhynchus | LC623822 |
| JN19-1 | 2019 | China.Shandong | Mosquito | OM572538 |
| LN1814 | 2018 | China.Liaoning | Mosquito | OM572545 |
| SX19117 | 2019 | China | Mosquito | OM572540 |
| ZJ18-44 | 2018 | China.zhejiang | Mosquito | OM572550 |
| TS00 | 2000 | Australia | Porcine | MT253732 |
| SH19 | 2016 | China | Anopheles sinensis | MH753131 |
| SH7 | 2016 | China | Culex tritaeniorhynchus | MH753129 |
| EHI-CX135 | 2019 | Singapore | Culex tritaeniorhynchus | ON804798 |
| SD12 | 2015 | China | Swine | MH753127 |
(1): The strain isolated from Fujian province in this study.
Distribution of mosquitoes in pig farms in Fujian, China.
| Species | Location | Total No. |
|||
|---|---|---|---|---|---|
| Fuqing (FQ) | Sanming (SM) | Nanping (NP) | |||
| YC |
YS |
YR |
LTS |
||
| Culex tritaeniorhynchus | 3954 (69.97%) | 3647 (72.06%) | 3501 (85%) | 3549 (81.66%) | 14,651 (76.40%) |
| Culex bitaeniorhynchus | 11 (0.19%) | 0 (0%) | 8 (0.19%) | 19 (0.44%) | 38 (0.2%) |
| Anopheles sinensis | 1107 (19.59%) | 1328 (26.24%) | 522 (12.67%) | 734 (16.89%) | 3691 (19.25%) |
| Culex pipiens pallens | 7 (0.12%) | 13 (0.26%) | 26 (0.63%) | 9 (0.21%) | 55 (0.29%) |
| Aedes vexans | 572 (10.12%) | 73 (1.44%) | 0 (0%) | 0 (0%) | 645 (3.36%) |
| Armigeres obturbans | 0 (0%) | 0 (0%) | 62 (1.51%) | 35 (0.81%) | 97 (0.51%) |
| Total | 5651 | 5061 | 4119 | 4346 | 19,177 |
| Percent of the sites | (29.47%) | (26.39%) | (21.48%) | (22.66%) | (100%) |
Summary of JEV isolates from mosquitoes and pig serums collected in Fujian, China.
| No. | Isolates | Collection Sites | Habitat | Host | Genotype |
|---|---|---|---|---|---|
| 1 | FJ1901 | YC | pigpen | Cx. tritaeniorhynchus | GI |
| 2 | FJ1902 | YC | pigpen | Swine | GI |
| 3 | FJ1903 | YS | pigpen | Cx. tritaeniorhynchus | GI |
| 4 | FJ1904 | YS | pigpen | Swine | GI |
| 5 | FJ1905 | LTS | pigpen | Cx. tritaeniorhynchus | GI |
Classification of samples collected from pig farms in Fujian Province and isolation of JEV virus in positive samples.
| Species | No. of Samples | No. of Positive Samples | ||||||
|---|---|---|---|---|---|---|---|---|
| YC | YS | YR | LTS | YC | YS | YR | LTS | |
| Culex tritaeniorhynchus | 79 | 73 | 70 | 71 | 2 (1 *) | 1 (1 *) | 1 | 2 (1 *) |
| Culex bitaeniorhynchus | 1 | 0 | 1 | 1 | 0 | 0 | 0 | 0 |
| Anopheles sinensis | 23 | 27 | 11 | 15 | 0 | 0 | 0 | 0 |
| Culex pipiens pallens | 1 | 1 | 1 | 1 | 0 | 0 | 0 | 0 |
| Aedes vexans | 12 | 2 | 0 | 0 | 0 | 0 | 0 | 0 |
| Armigeres obturbans | 0 | 0 | 2 | 1 | 0 | 0 | 0 | 0 |
| Swine blood | 30 | 30 | 30 | 30 | 3 (1 *) | 2 (1 *) | 1 | 2 |
No. of samples: the number of samples of each mosquito and pig blood from the farm; no. of positive samples: the number of samples verified as positive by PCR; *: the number of JEVs isolated from positive samples.
Comparison of key Japanese Encephalitis Virus E protein amino acid residues at sites associated with virulence in different Japanese Encephalitis Virus strains.
| JEV Strain GenBank | E47 | E76 | E107 | E123 | E129 | E138 | E160 | E176 | E222 | E227 | E244 | E259 | E264 | E279 | E312 | E315 | E327 | E366 | E408 | E439 | E441 | E487 | ||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| GII | SA14-14-2 | AF315119 | N | T | F | S | T | K | G | V | A | S | G | E | H | M | K | V | S | A | S | R | V | T |
| P3 | U47032 | N | M | L | S | A | E | G | I | A | P | E | E | Q | K | K | A | S | A | L | K | V | T | |
| SH0601 | EF543861 | N | M | L | S | T | E | G | I | A | P | E | E | Q | K | K | A | S | A | L | K | V | T | |
| FJ0339 | JN381859 | N | T | L | S | T | E | R | I | A | P | E | E | Q | K | R | A | S | A | S | K | I | I | |
| Fj02-29 | JF706273 | N | T | L | S | T | E | R | I | A | P | E | E | Q | K | R | A | S | A | S | K | I | I | |
| FJ07-51 | GQ856662 | N | T | L | S | T | E | G | I | A | P | E | K | Q | K | R | A | S | A | S | K | I | I | |
| FJ05-62 | GQ856660 | N | T | L | S | T | E | G | I | A | P | E | K | Q | K | R | A | S | A | S | K | I | I | |
| FJ08-48 | GQ856663 | N | T | L | S | T | E | G | I | A | P | E | K | Q | K | R | A | S | A | S | K | I | I | |
| GI | FJ1901 | OQ181396 | N | T | L | S | M | E | G | I | S | S | E | E | Q | K | K | A | T | S | S | K | V | T |
| FJ1902 | OQ181397 | N | T | L | S | M | E | G | I | S | S | E | E | Q | K | K | A | T | S | S | K | V | T | |
| FJ1903 | OQ181398 | N | T | L | S | M | E | G | I | S | S | E | E | Q | K | K | A | T | S | S | K | V | T | |
| FJ1904 | OQ181399 | N | T | L | S | M | E | G | I | S | S | E | E | Q | K | K | A | T | S | S | K | V | T | |
| FJ1905 | OQ181400 | N | T | L | S | M | E | G | I | S | S | E | E | Q | K | K | A | T | S | S | K | V | T | |
| SH-53 | JN381850 | N | T | L | S | M | E | G | I | S | S | E | E | Q | K | K | A | T | S | S | K | V | T | |
| SH-80 | JN381848 | N | T | L | S | M | E | G | I | S | S | E | E | Q | K | K | A | T | S | S | K | V | T | |
Minimum infection rate of JEV in mosquitoes in this study.
| Species | Specimen | Positive Pool | MIR (1) |
|---|---|---|---|
| Culex tritaeniorhynchus | 14,651 | 6 | 0.41/1000 |
(1): Minimum infection rate (MIR) expressed as number infected/1000 tested.
Supplementary Materials
The following supporting information can be downloaded at:
References
1. Mansfield, K.L.; Hernandez-Triana, L.M.; Banyard, A.C.; Fooks, A.R.; Johnson, N. Japanese encephalitis virus infection, diagnosis and control in domestic animals. Vet. Microbiol.; 2017; 201, pp. 85-92. [DOI: https://dx.doi.org/10.1016/j.vetmic.2017.01.014]
2. Pearce, J.C.; Learoyd, T.P.; Langendorf, B.J.; Logan, J.G. Japanese encephalitis: The vectors, ecology and potential for expansion. J. Travel Med.; 2018; 25, pp. S16-S26. [DOI: https://dx.doi.org/10.1093/jtm/tay009]
3. Sharma, K.B.; Vrati, S.; Kalia, M. Pathobiology of Japanese encephalitis virus infection. Mol. Asp. Med.; 2021; 81, 100994. [DOI: https://dx.doi.org/10.1016/j.mam.2021.100994]
4. Solomon, T.; Ni, H.; Beasley, D.W.; Ekkelenkamp, M.; Cardosa, M.J.; Barrett, A.D. Origin and evolution of Japanese encephalitis virus in southeast Asia. J. Virol.; 2003; 77, pp. 3091-3098. [DOI: https://dx.doi.org/10.1128/JVI.77.5.3091-3098.2003]
5. Hasan, S.S.; Sevvana, M.; Kuhn, R.J.; Rossmann, M.G. Structural biology of Zika virus and other flaviviruses. Nat. Struct. Mol. Biol.; 2018; 25, pp. 13-20. [DOI: https://dx.doi.org/10.1038/s41594-017-0010-8] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/29323278]
6. Zhu, Y.; He, Z.; Qi, Z. Virus-host Interactions in Early Japanese Encephalitis Virus Infection. Virus Res.; 2023; 331, 199120. [DOI: https://dx.doi.org/10.1016/j.virusres.2023.199120] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/37086856]
7. Halbach, R.; Junglen, S.; van Rij, R.P. Mosquito-specific and mosquito-borne viruses: Evolution, infection, and host defense. Curr. Opin. Insect Sci.; 2017; 22, pp. 16-27. [DOI: https://dx.doi.org/10.1016/j.cois.2017.05.004] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28805635]
8. Li, L.Y.; Deng, Y.P.; Zhang, Y.; Wu, Y.; Fu, Y.T.; Liu, G.H.; Liu, J.H. Characterization of the complete mitochondrial genome of Culex vishnui (Diptera: Culicidae), one of the major vectors of Japanese encephalitis virus. Parasitol. Res.; 2023; 122, pp. 1403-1414. [DOI: https://dx.doi.org/10.1007/s00436-023-07840-4]
9. Yu, X.; Zhu, Y.; Xiao, X.; Wang, P.; Cheng, G. Progress towards Understanding the Mosquito-Borne Virus Life Cycle. Trends Parasitol.; 2019; 35, pp. 1009-1017. [DOI: https://dx.doi.org/10.1016/j.pt.2019.09.006]
10. Ashraf, U.; Ding, Z.; Deng, S.; Ye, J.; Cao, S.; Chen, Z. Pathogenicity and virulence of Japanese encephalitis virus: Neuroinflammation and neuronal cell damage. Virulence; 2021; 12, pp. 968-980. [DOI: https://dx.doi.org/10.1080/21505594.2021.1899674]
11. Turtle, L.; Solomon, T. Japanese encephalitis—The prospects for new treatments. Nat. Rev. Neurol.; 2018; 14, pp. 298-313. [DOI: https://dx.doi.org/10.1038/nrneurol.2018.30]
12. Bhattachan, A.; Amatya, S.; Sedai, T.R.; Upreti, S.R.; Partridge, J. Japanese encephalitis in hill and mountain districts, Nepal. Emerg. Infect. Dis.; 2009; 15, pp. 1691-1692. [DOI: https://dx.doi.org/10.3201/eid1510.081641] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/19861079]
13. Campbell, G.L.; Hills, S.L.; Fischer, M.; Jacobson, J.A.; Hoke, C.H.; Hombach, J.M.; Marfin, A.A.; Solomon, T.; Tsai, T.F.; Tsu, V.D. et al. Estimated global incidence of Japanese encephalitis: A systematic review. Bull. World Health Organ.; 2011; 89, pp. 766-774. [DOI: https://dx.doi.org/10.2471/BLT.10.085233] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/22084515]
14. Erlanger, T.E.; Weiss, S.; Keiser, J.; Utzinger, J.; Wiedenmayer, K. Past, present, and future of Japanese encephalitis. Emerg. Infect. Dis.; 2009; 15, pp. 1-7. [DOI: https://dx.doi.org/10.3201/eid1501.080311]
15. Hammon, W.M.; Tigertt, W.D.; Sather, G.; Schenker, H. Isolations of Japanese B encephalitis virus from naturally infected Culex tritaeniorhynchus collected in Japan. Am. J. Hyg.; 1949; 50, pp. 51-56.
16. Mackenzie, J.S.; Williams, D.T.; van den Hurk, A.F.; Smith, D.W.; Currie, B.J. Japanese Encephalitis Virus: The Emergence of Genotype IV in Australia and Its Potential Endemicity. Viruses; 2022; 14, 2480. [DOI: https://dx.doi.org/10.3390/v14112480]
17. Zheng, Y.; Li, M.; Wang, H.; Liang, G. Japanese encephalitis and Japanese encephalitis virus in mainland China. Rev. Med. Virol.; 2012; 22, pp. 301-322. [DOI: https://dx.doi.org/10.1002/rmv.1710]
18. Misra, U.K.; Kalita, J. Overview: Japanese encephalitis. Prog. Neurobiol.; 2010; 91, pp. 108-120. [DOI: https://dx.doi.org/10.1016/j.pneurobio.2010.01.008] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/20132860]
19. Chen, W.R.; Rico-Hesse, R.; Tesh, R.B. A new genotype of Japanese encephalitis virus from Indonesia. Am. J. Trop. Med. Hyg.; 1992; 47, pp. 61-69. [DOI: https://dx.doi.org/10.4269/ajtmh.1992.47.61]
20. Le Flohic, G.; Porphyre, V.; Barbazan, P.; Gonzalez, J.P. Review of Climate, Landscape, and Viral Genetics as Drivers of the Japanese Encephalitis Virus Ecology. PLoS Negl. Trop. Dis.; 2013; 7, e2208. [DOI: https://dx.doi.org/10.1371/journal.pntd.0002208]
21. Scherer, W.F.; Moyer, J.T.; Izumi, T.; Gresser, I.; Mc, C.J. Ecologic studies of Japanese encephalitis virus in Japan. VI. Swine infection. Am. J. Trop. Med. Hyg.; 1959; 8, pp. 698-706. [DOI: https://dx.doi.org/10.4269/ajtmh.1959.8.698]
22. Zheng, B.; Wang, X.; Liu, Y.; Li, Y.; Long, S.; Gu, C.; Ye, J.; Xie, S.; Cao, S. Japanese Encephalitis Virus infection induces inflammation of swine testis through RIG-I-NF-kB signaling pathway. Vet. Microbiol.; 2019; 238, 108430. [DOI: https://dx.doi.org/10.1016/j.vetmic.2019.108430]
23. Auerswald, H.; Maquart, P.O.; Chevalier, V.; Boyer, S. Mosquito Vector Competence for Japanese Encephalitis Virus. Viruses; 2021; 13, 1154. [DOI: https://dx.doi.org/10.3390/v13061154] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/34208737]
24. Faizah, A.N.; Kobayashi, D.; Amoa-Bosompem, M.; Higa, Y.; Tsuda, Y.; Itokawa, K.; Miura, K.; Hirayama, K.; Sawabe, K.; Isawa, H. Evaluating the competence of the primary vector, Culex tritaeniorhynchus, and the invasive mosquito species, Aedes japonicus japonicus, in transmitting three Japanese encephalitis virus genotypes. PLoS Negl. Trop. Dis.; 2020; 14, e0008986.Erratum in PLoS Negl. Trop. Dis. 2023, 17, e0011052 [DOI: https://dx.doi.org/10.1371/journal.pntd.0011052] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/36634069]
25. Van den Eynde, C.; Sohier, C.; Matthijs, S.; De Regge, N. Japanese Encephalitis Virus Interaction with Mosquitoes: A Review of Vector Competence, Vector Capacity and Mosquito Immunity. Pathogens; 2022; 11, 317. [DOI: https://dx.doi.org/10.3390/pathogens11030317]
26. Chen, D.; Wang, H.Y.; Fu, S.H.; Song, H.; Deng, J.; Yang, Y.L.; Liang, G.D. Molecular characteristics of three new isolates of Japanese encephalitis virus in Fujian Province. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi; 2005; 19, pp. 5-8.
27. Hameed, M.; Wahaab, A.; Shan, T.; Wang, X.; Khan, S.; Di, D.; Xiqian, L.; Zhang, J.J.; Anwar, M.N.; Nawaz, M. et al. A Metagenomic Analysis of Mosquito Virome Collected from Different Animal Farms at Yunnan-Myanmar Border of China. Front. Microbiol.; 2020; 11, 591478. [DOI: https://dx.doi.org/10.3389/fmicb.2020.591478] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/33628201]
28. Xiao, C.G.; Li, C.X.; Di, D.; Cappelle, J.; Liu, L.H.; Wang, X.; Pang, L.L.; Xu, J.P.; Liu, K.; Li, B.B. et al. Differential replication efficiencies between Japanese encephalitis virus genotype I and III in avian cultured cells and young domestic ducklings. PLoS Negl. Trop. Dis.; 2018; 12, e0007046. [DOI: https://dx.doi.org/10.1371/journal.pntd.0007046]
29. Yang, D.K.; Kim, B.H.; Kweon, C.H.; Kwon, J.H.; Lim, S.I.; Han, H.R. Biophysical characterization of Japanese encephalitis virus (KV1899) isolated from pigs in Korea. J. Vet. Sci.; 2004; 5, pp. 125-130. [DOI: https://dx.doi.org/10.4142/jvs.2004.5.2.125]
30. Kumar, S.; Tamura, K.; Nei, M. MEGA3: Integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform.; 2004; 5, pp. 150-163. [DOI: https://dx.doi.org/10.1093/bib/5.2.150]
31. Zhou, Y.; Wu, R.; Zhao, Q.; Chang, Y.F.; Wen, X.; Feng, Y.; Huang, X.; Wen, Y.; Yan, Q.; Huang, Y. et al. Mutation of I176R in the E coding region weakens Japanese encephalitis virus neurovirulence, but not its growth rate in BHK-21 cells. Arch Virol.; 2018; 163, pp. 1351-1355. [DOI: https://dx.doi.org/10.1007/s00705-018-3765-2]
32. Zheng, X.; Zheng, H.; Tong, W.; Li, G.; Wang, T.; Li, L.; Gao, F.; Shan, T.; Yu, H.; Zhou, Y. et al. Acidity/Alkalinity of Japanese Encephalitis Virus E Protein Residue 138 Alters Neurovirulence in Mice. J. Virol.; 2018; 92, [DOI: https://dx.doi.org/10.1128/JVI.00108-18] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/30158291]
33. Yamaguchi, Y.; Nukui, A.; Kotaki, K.; Sawabe, M.; Watanabe, H.; Kurane, I.; Takasaki, T.; Tajima, S. Characterization of a serine-to-asparagine substitution at position 123 in the Japanese encephalitis virus E protein. J Gen Virol.; 2012; 94, pp. 90-96. [DOI: https://dx.doi.org/10.1099/vir.0.044925-0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/23052392]
34. Tajima, S.; Shibasaki, K.I.; Taniguchi, S.; Nakayama, E.; Maeki, T.; Lim, C.K.; Saijo, M. E and prM proteins of genotype V Japanese encephalitis virus are required for its increased virulence in mice. Heliyon; 2019; 5, e02882. [DOI: https://dx.doi.org/10.1016/j.heliyon.2019.e02882]
35. Yun, S.I.; Song, B.H.; Kim, J.K.; Yun, G.N.; Lee, E.Y.; Li, L.; Kuhn, R.J.; Rossmann, M.G.; Morrey, J.D.; Lee, Y.M. A molecularly cloned, live-attenuated japanese encephalitis vaccine SA14-14-2 virus: A conserved single amino acid in the ij Hairpin of the Viral E glycoprotein determines neurovirulence in mice. PLoS Pathog.; 2014; 10, e1004290. [DOI: https://dx.doi.org/10.1371/journal.ppat.1004290]
36. Yang, J.; Yang, H.; Li, Z.; Wang, W.; Lin, H.; Liu, L.; Ni, Q.; Liu, X.; Zeng, X.; Wu, Y. et al. Envelope Protein Mutations L107F and E138K Are Important for Neurovirulence Attenuation for Japanese Encephalitis Virus SA14-14-2 Strain. Viruses; 2017; 9, 20. [DOI: https://dx.doi.org/10.3390/v9010020] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28117725]
37. Monath, T.P.; Arroyo, J.; Levenbook, I.; Zhang, Z.X.; Catalan, J.; Draper, K.; Guirakhoo, F. Single mutation in the flavivirus envelope protein hinge region increases neurovirulence for mice and monkeys but decreases viscerotropism for monkeys: Relevance to development and safety testing of live, attenuated vaccines. J Virol.; 2002; 76, pp. 1932-1943. [DOI: https://dx.doi.org/10.1128/JVI.76.4.1932-1943.2002]
38. Heffelfinger, J.D.; Li, X.; Batmunkh, N.; Grabovac, V.; Diorditsa, S.; Liyanage, J.B.; Pattamadilok, S.; Bahl, S.; Vannice, K.S.; Hyde, T.B. et al. Japanese Encephalitis Surveillance and Immunization—Asia and Western Pacific Regions, 2016. MMWR Morb. Mortal Wkly. Rep.; 2017; 66, pp. 579-583. [DOI: https://dx.doi.org/10.15585/mmwr.mm6622a3]
39. Kuwata, R.; Torii, S.; Shimoda, H.; Supriyono, S.; Phichitraslip, T.; Prasertsincharoen, N.; Takemae, H.; Bautista, R.; Ebora, V.; Abella, J.A.C. et al. Distribution of Japanese Encephalitis Virus, Japan and Southeast Asia, 2016-2018. Emerg. Infect. Dis.; 2020; 26, pp. 125-128. [DOI: https://dx.doi.org/10.3201/eid2601.190235]
40. Lim, M.J.; Loh, Z.Y.; Yeo, H.L.; Yenamandra, S.P.; Kong, M.; Pang, H.Y.; Lee, M.H.; Humaidi, M.; Chua, C.; Griffiths, J. et al. Isolation and Genetic Characterization of Japanese Encephalitis Virus Two Decades after Its Elimination in Singapore. Viruses; 2022; 14, 2662. [DOI: https://dx.doi.org/10.3390/v14122662]
41. Cao, Q.S.; Li, X.M.; Zhu, Q.Y.; Wang, D.D.; Chen, H.C.; Qian, P. Isolation and molecular characterization of genotype 1 Japanese encephalitis virus, SX09S-01, from pigs in China. Virol. J.; 2011; 8, 472. [DOI: https://dx.doi.org/10.1186/1743-422X-8-472]
42. Chai, C.; Wang, Q.; Cao, S.; Zhao, Q.; Wen, Y.; Huang, X.; Wen, X.; Yan, Q.; Ma, X.; Wu, R. Serological and molecular epidemiology of Japanese encephalitis virus infections in swine herds in China, 2006–2012. J. Vet. Sci.; 2018; 19, pp. 151-155. [DOI: https://dx.doi.org/10.4142/jvs.2018.19.1.151] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/28693301]
43. Deng, X.; Yan, J.Y.; He, H.Q.; Yan, R.; Sun, Y.; Tang, X.W.; Zhou, Y.; Pan, J.H.; Mao, H.Y.; Zhang, Y.J. et al. Serological and molecular epidemiology of Japanese Encephalitis in Zhejiang, China, 2015–2018. PLoS Negl. Trop. Dis.; 2020; 14, e0008574. [DOI: https://dx.doi.org/10.1371/journal.pntd.0008574] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/32853274]
44. Wang, H.Y.; Fu, S.H.; Li, X.Y.; Song, H.; Min, J.G.; Deng, J.; Yang, Y.L.; Kurane, I. First isolation of genotype I encephalitis B virus in China. Chin. J. Microbiol. Immunol.; 2004; 24, 7.
45. He, X.X.; Wang, H.Y.; Fu, S.H.; He, Y.; Yang, F.Z.; Chen, W.X.; Xu, B.H.; Lu, S.N.; Xie, H.G.; Ha, S.S. et al. Genotype I Japanese encephalitis virus is the main genotype in mosquito in Fujian province. Chin. J. Exp. Clin. Virol.; 2012; 26, pp. 81-83.
46. Chen, W.R.; Tesh, R.B.; Rico-Hesse, R. Genetic variation of Japanese encephalitis virus in nature. J. Gen. Virol.; 1990; 71, pp. 2915-2922. [DOI: https://dx.doi.org/10.1099/0022-1317-71-12-2915]
47. Chen, N.; Yu, Y.X. Progress in the research of phenotype and genotype of Japanese encephalitis virus in China. Bing Du Xue Bao.; 2013; 29, pp. 457-464.
48. Fang, Y.; Zhang, Y.; Zhou, Z.B.; Xia, S.; Shi, W.Q.; Xue, J.B.; Li, Y.Y.; Wu, J.T. New strains of Japanese encephalitis virus circulating in Shanghai, China after a ten-year hiatus in local mosquito surveillance. Parasit Vectors; 2019; 12, 22. [DOI: https://dx.doi.org/10.1186/s13071-018-3267-9]
49. Gao, X.Y.; Liu, H.; Li, M.H.; Fu, S.H.; Liang, G.D. Insights into the evolutionary history of Japanese encephalitis virus (JEV) based on whole-genome sequences comprising the five genotypes. Virol. J.; 2015; 12, 43. [DOI: https://dx.doi.org/10.1186/s12985-015-0270-z]
50. Li, Y.X.; Li, M.H.; Fu, S.H.; Chen, W.X.; Liu, Q.Y.; Zhang, H.L.; Da, W.; Hu, S.L.; Mu, S.D.; Bai, J. et al. Japanese encephalitis, Tibet, China. Emerg Infect Dis.; 2011; 17, pp. 934-936. [DOI: https://dx.doi.org/10.3201/eid1705.101417]
51. Teng, M.; Luo, J.; Fan, J.M.; Chen, L.; Wang, X.T.; Yao, W.; Wang, C.Q.; Zhang, G.P. Molecular characterization of Japanese encephalitis viruses circulating in pigs and mosquitoes on pig farms in the Chinese province of Henan. Virus Genes; 2013; 46, pp. 170-174. [DOI: https://dx.doi.org/10.1007/s11262-012-0813-y]
52. Wang, H.Y.; Takasaki, T.; Fu, S.H.; Sun, X.H.; Zhang, H.L.; Wang, Z.X.; Hao, Z.Y.; Zhang, J.K.; Tang, Q.; Kotaki, A. et al. Molecular epidemiological analysis of Japanese encephalitis virus in China. J. Gen. Virol.; 2007; 88, pp. 885-894. [DOI: https://dx.doi.org/10.1099/vir.0.82185-0] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/17325361]
53. Beasley, D.W.; Lewthwaite, P.; Solomon, T. Current use and development of vaccines for Japanese encephalitis. Expert Opin. Biol. Ther.; 2008; 8, pp. 95-106. [DOI: https://dx.doi.org/10.1517/14712598.8.1.95]
54. Halstead, S.B.; Thomas, S.J. New Japanese encephalitis vaccines: Alternatives to production in mouse brain. Expert Rev. Vaccines; 2011; 10, pp. 355-364. [DOI: https://dx.doi.org/10.1586/erv.11.7] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/21434803]
55. Wilder-Smith, A.; Halstead, S.B. Japanese encephalitis: Update on vaccines and vaccine recommendations. Curr. Opin. Infect Dis.; 2010; 23, pp. 426-431. [DOI: https://dx.doi.org/10.1097/QCO.0b013e32833c1d01]
56. Li, C.X.; Di, D.; Huang, H.; Wang, X.; Xia, Q.Q.; Ma, X.C.; Liu, K.; Li, B.B.; Shao, D.H.; Qiu, Y.F. et al. NS5-V372A and NS5-H386Y variations are responsible for differences in interferon alpha/beta induction and co-contribute to the replication advantage of Japanese encephalitis virus genotype I over genotype III in ducklings. PLoS Pathog.; 2020; 16, e1008773. [DOI: https://dx.doi.org/10.1371/journal.ppat.1008773]
57. Han, N.; Adams, J.; Chen, P.; Guo, Z.Y.; Zhong, X.F.; Fang, W.; Li, N.; Wen, L.; Tao, X.Y.; Yuan, Z.M. et al. Comparison of Genotypes I and III in Japanese Encephalitis Virus Reveals Distinct Differences in Their Genetic and Host Diversity. J. Virol.; 2014; 88, pp. 11469-11479. [DOI: https://dx.doi.org/10.1128/JVI.02050-14] [PubMed: https://www.ncbi.nlm.nih.gov/pubmed/25056890]
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance with the terms of the License.
Abstract
Japanese encephalitis (JE), found in pigs, is a serious mosquito-borne zoonotic infectious disease caused by the Japanese encephalitis virus (JEV). JEV is maintained in an enzootic cycle between mosquitoes and amplifying vertebrate hosts, mainly pigs and wading birds. It is transmitted to humans through the bite of an infected mosquito, allowing the pathogen to spread and cause disease epidemics. However, there is little research on JEV genotype variation in mosquitoes and pigs in Fujian province. Previous studies have shown that the main epidemic strain of JEV in Fujian Province is genotype III. In this study, a survey of mosquito species diversity in pig farms and molecular evolutionary analyses of JEV were conducted in Fujian, China, in the summer of 2019. A total of 19,177 mosquitoes were collected at four sites by UV trap. Four genera were identified, of which the Culex tritaeniorhynchus was the most common mosquito species, accounting for 76.4% of the total (14,651/19,177). Anopheles sinensi (19.25%, 3691/19,177) was the second largest species. High mosquito infection rateswere an important factor in the outbreak. The captured mosquito samples were milled and screened with JEV-specific primers. Five viruses were isolated, FJ1901, FJ1902, FJ1903, FJ1904, and FJ1905. Genetic affinity was determined by analyzing the envelope (E) gene variants. The results showed that they are JEV gene type I and most closely related to the strains SH-53 and SD0810. In this study, it was found through genetic evolution analysis that the main epidemic strain of JE in pig farms changed from gene type III to gene type I. Compared with the SH-53 and SD0810 strains, we found no change in key sites related to antigenic activity and neurovirulence of JEV in Fujian JEV and pig mosquito strains, respectively. The results of the study provide basic data for analyzing the genotypic shift of JEV in Fujian Province and support the prevention and control of JEV.
You have requested "on-the-fly" machine translation of selected content from our databases. This functionality is provided solely for your convenience and is in no way intended to replace human translation. Show full disclaimer
Neither ProQuest nor its licensors make any representations or warranties with respect to the translations. The translations are automatically generated "AS IS" and "AS AVAILABLE" and are not retained in our systems. PROQUEST AND ITS LICENSORS SPECIFICALLY DISCLAIM ANY AND ALL EXPRESS OR IMPLIED WARRANTIES, INCLUDING WITHOUT LIMITATION, ANY WARRANTIES FOR AVAILABILITY, ACCURACY, TIMELINESS, COMPLETENESS, NON-INFRINGMENT, MERCHANTABILITY OR FITNESS FOR A PARTICULAR PURPOSE. Your use of the translations is subject to all use restrictions contained in your Electronic Products License Agreement and by using the translation functionality you agree to forgo any and all claims against ProQuest or its licensors for your use of the translation functionality and any output derived there from. Hide full disclaimer





