Com texto completo
ARTICLE
Received 24 Feb 2016 | Accepted 30 Jun 2016 | Published 11 Aug 2016
Javier Martinez-Picado1,2,3,*, Paul J. McLaren4,5,*, Itziar Erkizia1, Maureen P. Martin6, Susana Benet1,
Margalida Rotger7, Judith Dalmau1, Dan Ouchi1, Steven M. Wolinsky8, Sudhir Penugonda8,Huldrych F. Gnthard9,10, Jacques Fellay11,12, Mary Carrington6,13, Nuria Izquierdo-Useros1,** & Amalio Telenti14,**
Siglec-1/CD169 is a myeloid-cell surface receptor critical for HIV-1 capture and infection of bystander target cells. To dissect the role of SIGLEC1 in natura, we scan a large population genetic database and identify a loss-of-function variant (Glu88Ter) that is found in B1% of healthy people. Exome analysis and direct genotyping of 4,233 HIV-1-infected individuals reveals two Glu88Ter homozygous and 97 heterozygous subjects, allowing the analysis of ex vivo and in vivo consequences of SIGLEC1 loss-of-function. Cells from these individuals are functionally null or haploinsufcient for Siglec-1 activity in HIV-1 capture and trans-infection ex vivo. However, Siglec-1 protein truncation does not have a measurable impact on HIV-1 acquisition or AIDS outcomes in vivo. This result contrasts with the known in vitro functional role of Siglec-1 in HIV-1 trans-infection. Thus, it provides evidence that the classical HIV-1 infectious routes may compensate for the lack of Siglec-1 in fuelling HIV-1 dissemination within infected individuals.
1 AIDS Research Institute IrsiCaixa, Institut dInvestigaci en Cincies de la Salut Germans Trias i Pujol (IGTP), Universitat Autnoma de Barcelona, 08916 Badalona, Spain. 2 Instituci Catalana de Recerca i Estudis Avanats (ICREA), 08010 Barcelona, Spain. 3 University of Vic-Central University of Catalonia (UVic-UCC), 08500 Vic, Barcelona, Spain. 4 National HIV and Retrovirology Laboratory, Public Health Agency of Canada, Winnipeg, MB, Canada R3E 0W3.
5 Department of Medical Microbiology and Infectious Diseases, University of Manitoba, Winnipeg, MB, Canada R3E 0J9. 6 Cancer and Inammation Program, Laboratory of Experimental Immunology, Leidos Biomedical Research, Inc., Frederick National Laboratory for Cancer Research, Frederick, Maryland 21702, USA. 7 Institute of Microbiology, University Hospital Center and University of Lausanne, 1011 Lausanne, Switzerland. 8 Department of Medicine, Northwestern University Feinberg School of Medicine, Chicago, Illinois 60611, USA. 9 Division of Infectious Diseases and Hospital Epidemiology, University Hospital Zurich, University of Zurich, 8091 Zurich, Switzerland. 10 Institute of Medical Virology, University of Zurich, 8057 Zurich, Switzerland. 11 School of Life Sciences,cole Polytechnique Fdrale de Lausanne, 1015 Lausanne, Switzerland. 12 Swiss Institute of Bioinformatics, 1015 Lausanne, Switzerland. 13 Ragon Institute for MGH, MIT and Harvard, Cambridge, Massachusetts 02139, USA. 14 Genomic Medicine, J. Craig Venter Institute, La Jolla, California 12037, USA. * These authors contributed equally to this work. ** These authors jointly supervised this work. Correspondence and requests for materials should be addressed toJ.M.-P. (email: mailto:jmpicado@irsicaixa.es
Web End =jmpicado@irsicaixa.es ) or to N.I.-U. (email: mailto:nizquierdo@irsicaixa.es
Web End =nizquierdo@irsicaixa.es ) or to A.T. (email: mailto:atelenti@jcvi.org
Web End =atelenti@jcvi.org ).
NATURE COMMUNICATIONS | 7:12412 | DOI: 10.1038/ncomms12412 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 1
DOI: 10.1038/ncomms12412 OPEN
Identication of Siglec-1 null individuals infected with HIV-1
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms12412
Antigen presenting cells of the myeloid lineage, such as monocytes, macrophages and dendritic cells, initiate immune responses and are crucial to control invading
viruses. In the case of HIV-1 infection, however, myeloid cells also promote viral pathogenesis through trans-infection of CD4
T cells1,2. This mechanism involves HIV-1 capture by sialic acid-binding Ig-like lectin 1 (Siglec-1/CD169), a myeloid-cell receptor that recognizes viral membrane gangliosides36. Viral capture facilitates the release of trapped viruses at a cell-to-cell contact zone promoting the trans-infection of CD4 T cells7.
Immune activating signals, such as interferon alpha (IFNa) or bacterial lipopolysaccharide, are present throughout the course of HIV-1 infection8 and induce Siglec-1 expression on myeloid cells5,6,9. However, under these inammatory conditions, DC-SIGN and other C-type lectin receptors previously implicated in HIV-1 trans-infection2,10 play a minor role in viral transmission5,6,11. Thus, Siglec-1 is an important inducible receptor that could accelerate HIV-1 transmission in lymphatic tissues, where many T-cells are in contact with myeloid cells. Recent studies performed in vivo in mouse models demonstrated that the robust infection of retroviruses in secondary lymphoid tissues requires Siglec-1 and does not rely on the mouse DC-SIGN homolog12. Siglec-1 trans-infection, cell-free virus infection and cell-to-cell viral transfer between infected and non-infected cells are all important routes of viral dissemination. Yet, the relative contribution of trans-infection to HIV-1 transmission and AIDS disease progression remains unknown.
There has been considerable interest in using human genetic diversity to dissect the role of various genes in defence against pathogens in natura13. Recently, protein-truncating variants have been catalogued in the human genome1417. These are variants that are likely to disrupt the function of the corresponding allele18,19. The identication of the CCR5D32 variant was pivotal to understanding how human genetic variation contributes to differences in susceptibility to HIV-1 infection20, equally affecting all routes of viral spread.
Here, we aimed to identify SIGLEC1 null individuals to dissect the specic contribution of trans-infection to HIV-1 pathogenesis in vivo. We nd individuals with a specic loss-of-function variant in SIGLEC1 gene that completely abrogates Siglec-1 receptor expression on primary monocytes and their capacity to trans-infect HIV-1 ex vivo. Despite this ex vivo phenotype there is a striking absence of marked differences in HIV-1 acquisition or clinical evolution of individuals carrying SIGLEC1 loss-of-function alleles.
ResultsGenetic description of SIGLEC1 variants. We used data from the Exome Aggregation Consortium (ExAc.broadinstitute.org) to identify naturally occurring knockout mutations in SIGLEC1. In that sample of B63,000 individuals we observed 70 protein truncating variants, that is, stop-gain, frameshift or splice site (Fig. 1). With the exception of rs150358287, a stop-gain variant resulting in an early stop codon at amino acid position 88 (Glu88Ter), truncating variants are of very low frequency (o1%).
The Glu88Ter variant occurs in the second exon of SIGLEC1 (C to A transversion at position 3706494 on chromosome 20, GRCh 38 build reference sequence) and is predicted to truncate both major transcripts of SIGLEC1. The stop-gain allele is found at highest frequency in individuals of European and South Asian ancestry (B1.3%) and is rare or absent in African and East
Asian populations (o0.5%).
To assess the frequency distribution of this polymorphism in an HIV-1-infected population, we combined genotype data from exome sequencing (n 392), exome chip (n 2,212) and direct
genotyping (n 1,129) in participants of the Swiss HIV Cohort
Study (SHCS). In 3,733 individuals whose clinical characteristics are detailed in Table 1 (95% reported European ancestry), we observed 85 Glu88Ter heterozygotes and 2 homozygotes for the stop-gain variant (allele frequency 1.2%). Thus, we identied
individuals in whom to assess the consequences of Siglec-1 haploinsufciency and knockout in vivo and ex vivo.
Functional analysis of SIGLEC1 null variant. To conrm that Siglec-1 Glu88Ter homozygous individuals truly lack receptor expression, we performed functional assays with cryopreserved cells collected from individuals with all three possible genotypes. We induced Siglec-1 expression in isolated monocytes using IFNa and determined the absolute number of Siglec-1 antibody binding sites per monocyte (Fig. 2a). Compared to individuals homozygous for the common allele, heterozygous individuals expressed approximately half of the amount of protein observed, while null individuals showed only background expression levels (Fig. 2a). Next, we analyzed the ability of monocytes to capture uorescent HIV-1 virus-like particles (VLPs) displaying specic gangliosides that are efciently recognized by Siglec-1 (refs 3,4). IFNa-activated monocytes from individuals with the common allele showed the highest viral capture capacity followed by heterozygous and then by null individuals (Fig. 2b), which captured only residual levels of VLPs. To investigate whether this binding was specic for Siglec-1, cells were pre-treated with a monoclonal antibody (mAb) against Siglec-1. Treatment led to a signicant reduction of VLP uptake in monocytes from common allele and heterozygous individuals (Fig. 2b), while it had no inhibitory effect on SIGLEC1 null individuals. The VLP uptake of monocytes from distinct SIGLEC1 genotypes strongly correlated with the mean number of Siglec-1 antibody binding sites per cell (Fig. 2c). To assess the general HIV-1 transfer capacity of Siglec-1 compared to other possible receptors on IFNa-activated monocytes from homozygous individuals, we pulsed cells with equal amounts of infectious HIV-1NL4-3 in the presence or
absence of blocking mAbs and co-cultured them with a CD4 reporter cell line (Fig. 2d). Monocytes from individuals with the common allele had higher capacity to trans-infect than did SIGLEC1 null cells (Fig. 2d). Trans-infection was inhibited with a mAb against Siglec-1, which had no blocking effect on SIGLEC1 null monocytes (Fig. 2d). Overall, these results indicated that SIGLEC1 null individuals lack functional Siglec-1 expression and HIV-1 trans-infection capacity, ruling out genetic compensation mechanisms or a possible stop codon read-through that could alleviate the null status21.
SIGLEC1 null variant in HIV-1 acquisition. We next tested for an impact of the Glu88Ter variant on HIV-1 acquisition. Given the population frequency differences at which this variant occurs, we limited these analyses to 3,558 individuals of European ancestry to prevent confounding. The working hypothesis is that if Siglec-1 were essential for infection, homozygous Glu88Ter would not be infectedat least via mucosal exposure. The observation of two HIV-1-infected Glu88Ter homozygotes ruled out a requirement for a functional Siglec-1 protein in HIV-1 acquisition (that is, it does not mirror the CCR5D32 effect regarding R5-tropic virus infection). In addition, the observed frequency of the Glu88Ter allele in the HIV-1-infected population (1.2%) is nearly identical to the frequency in Europeans from the ExAc sample (1.3%) and does not differ depending on route of infection (1.15% parenteral, 1.2% sexual, P 0.95). Taken
together, these results suggest that functional SIGLEC1 is not required for HIV-1 acquisition regardless of route of exposure.
2 NATURE COMMUNICATIONS | 7:12412 | DOI: 10.1038/ncomms12412 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms12412 ARTICLE
Domains
Amino acid
Frequency of variants
HIV-1
N-ter
position
1e5 1e4 1e3 1e2
19
136
1,631
1,709
Sialyllactose
-containing gangliosides
SIGLEC-1
Signal peptide
1
V-set
Ig-like C2
Transmembrane & intracellular
340
680
1,020
1,360
1,700
Stop gain Frameshift
Splice site
Glu88Ter
C-ter
Figure 1 | Location and frequency of SIGLEC1 protein truncating variants. Protein domains are represented in different colours. Data from the Exome Aggregation Consortium (exac.broadinstitute.org) identies 70 protein truncating variants in SIGLEC1 including 33 stop gain (red), 24 frameshift (yellow) and 12 splice disrupting (blue) variants. Grey boxes indicate amino acid blocks encoded by each exon. With the exception of Glu88Ter, allprotein truncating variants occur at o1% frequency. Glu88Ter is located in the V-set domain of Siglec-1, the region that recognizes sialyllactose in
HIV-1 membrane gangliosides.
Table 1 | Clinical characteristics of the SHCS cohort.
Glu88Ter (homozygous and heterozygous) Glu88 (homozygous)
Male n; (%) 65 (74.7%) 2835 (77.7%)
Female n; (%) 22 (25.3%) 808 (22.3%)
Age median; (IQR) 46 (4150) 47 (4153) Caucasian n; (%) 80 (94.1%) 3447 (95.3%)
Peak viremia median; (IQR) 168,423 (42,036; 440,051) 103,094 (31,314; 290,000) CD4 nadir median; (IQR) 236 (118; 306) 225 (121; 323)
Mode of HIV-1 acquisition n; (%)
Heterosexual 25 (29.4%) 1,116 (30.7%) Homosexual 39 (45.9%) 1,617 (44.7%) Intravenous drug user 20 (23.5%) 764 (21.1%) Other/unknown 1 (1.2%) 120 (3.3%)
IQR, interquartile range.
SIGLEC1 null variant in HIV-1 progression. We assessed the potential impact of the SIGLEC1 null variant on HIV-1 viral load and disease progression. As shown in Fig. 3, the presence of one or two copies of the Siglec-1 Glu88Ter allele had no impact on plasma set point viral load (n 2,243; Fig. 3a). Similarly, there
was no difference in CD4 T-cell dynamics (n 2,302; Fig. 3b)
or in CD4 T-cell nadir. We also investigated the disease course (viral RNA level and CD4 T-cell counts) for the two homozygous Glu88Ter individuals, which supported viral replication (Fig. 3c). Finally, we assessed the impact of the Glu88Ter variant on progression to AIDS (as dened in 1987) in the SHCS (Fig. 3d), where we analyzed 52 Glu88Ter heterozygous
NATURE COMMUNICATIONS | 7:12412 | DOI: 10.1038/ncomms12412 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 3
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms12412
a b
3,500
50
VLP HIV-1 Gag eGFP capture
SIGLEC1 Glu88Ter allele count
0
1
2
P = 0.0098
P = 0.0024
3,000
Siglec-1 antibody binding sites
per monocyte
40
2,500
30
2,000
20
P = 0.0108
P = 0.0153
1,500
10
1,000
No VLP -Siglec-1
Isotype
No VLP -Siglec-1
Isotype
No VLP -Siglec-1
Isotype
500
0
0
c d
128 Rho =0.9725
1.0
P < 0.0001
VLP HIV-1 Gag eGFP capture
HIV-1 NL43 trans-infection
64
0.8
0.6
32
0.4
16
0.2
8
0.0
Isotype
Isotype
102 103 104
Siglec-1 antibody binding sites per monocyte
-Siglec-1
-Siglec-1
Figure 2 | Siglec-1 expression and trans-infection across distinct SIGLEC1 genotypes. Monocytes were isolated and cultured 24 h in the presence of 1,000 U ml 1 of IFNa to induce Siglec-1 expression. (a) Quantication of Siglec-1 expression levels assessed by ow cytometry. Empty box represents a repeat analysis of one Siglec-1 null homozygote. (b) Capture of uorescent HIV-1 VLPs by monocytes from distinct genotypes previously exposed to isotype or a-Siglec-1 mAbs. Geometric mean uorescence intensity of monocytes not exposed to VLPs is also depicted to show the background levels of the assay (empty bars). (c) Correlation between Siglec-1 expression levels and viral capture values of isotype-treated monocytes. (d) HIV-1 transmission to a reporter CD4 cell line from monocytes of opposing homozygous individuals pre-incubated with isotype or a-Siglec-1 mAbs. HIV-1 infection of reporter cells was determined by induced luciferase activity. Data show mean relative light units and SEM of cells from two homozygous individuals with the common allele and one Siglec-1 null homozygote.
and 1 homozygous individuals out of 2,511 individuals. We performed the same analysis in an independent cohort (the Multicenter AIDS Cohort Study, MACS) after genotyping 413 Caucasian HIV-1-infected individuals with documented seroconversion date (Fig. 3e). In the MACS cohort, we identied 12 heterozygous individuals, but no homozygous Glu88Ter individuals were found. Although there was a slow progression to AIDS observed in both the SHCS and MACS cohorts for Glu88Ter individuals, it did not reach statistical signicance.
DiscussionThe identication of two homozygous HIV-1-infected individuals with a conrmed loss-of-function variant in SIGLEC1, both of whom were infected via mucosal exposure, indicates that Siglec-1 trans-infection is not indispensable to establish HIV-1 infection through sexual contact. Thus, Siglec-1 independent mechanisms of infection are sufcient to support mucosal HIV-1 spread. In the absence of trans-infection, the classical HIV-1 infectious routes, including cell-free virus infection or cell-to-cell HIV-1 transmission, compensate for the lack of Siglec-1 and are able to fuel HIV-1 dissemination within infected individuals. This explains why we did not identify marked differences in clinical evolution of individuals with one or two copies of the Siglec-1 Glu88Ter allele.
Given the available sample size of this study and the low Glu88Ter frequency, we can only rule out a large effect of this allele on disease progression. Power simulations indicate that we
would need 410,000 samples to detect a relative risk of 5 (similar to the effect of B*57:01 on HIV-1 control) at Po0.05 under a recessive model. This sample size far exceeds even the largest genome-wide studies of HIV-1 progression that comprises B6,000 patients22, which unfortunately does not genotype the
Glu88Ter variant and cannot be used to accurately impute the presence of this rare allele. In addition, given that the proposed effect (if any) requires long-term follow-up off therapy (410 years) it is extremely unlikely that a sufcient sample size could be reached to assess the long-term consequences of this variant on HIV-1 disease. However, the identication of the functional consequences of the Glu88Ter allele might encourage future genetic studies to include this variant and complement our analyses.
These results in humans are in contrast to those observed in the BLT humanized mouse model, where Siglec-1 blockade signicantly lowered HIV-1 infection of splenocytes12. Discrepancies could be attributed to the fact that our study mainly focused on heterozygous Siglec-1 Glu88Ter individuals, which maintain partial receptor expression and function. Yet, the clinical course of the two homozygous individuals did not show any obvious benet of absence of Siglec-1. Alternatively, differences with the murine model could be due to the distinct timeframes analyzed in each case. The murine study was limited to the early dynamics of HIV-1 infection12, a phase that is missing from the clinical records of most patients, including the two null-homozygous individuals identied here. Hence, it will be important to determine if the lack
4 NATURE COMMUNICATIONS | 7:12412 | DOI: 10.1038/ncomms12412 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms12412 ARTICLE
a
8
b
P = 0.55
1,200
CD4+ T- cell count
Log 10viral RNA
6
Glu88Ter allele count
0
1
2
1,000
800
4
600
400
2
200
0
8,000 6,000 4,000 2,000 0
0 1 2
Days before antiretroviral therapy
Glu88Ter allele count
c
1,200
CD4+ T- cell count
HIV+ ART Deceased
Years
6
Log 10viral RNA
1,000
5
800
4
600
3
400
2
200
1
0
0
10
8 6 4 2 0 2 4 6 8 10 12 14 16 18
1,200
CD4+ T- cell count
HIV+ ART Ongoing
HAART
6
Log 10viral RNA
1,000
5
800
4
600
3
400
2
200
1
0
0
10
8 6 4 2 0 2 4 6 8 10 12 14 16 18
d e
1.0
1.0
Glu88Ter Glu88Ter +
Glu88Ter Glu88Ter +
Proportion of sample
0.8
0.8
Proportion of sample
0.6
0.6
0.4
0.4
0.2
0.2
0.0
0.0
0 5 10 15
0 5 10 15 20 25Years of follow-up
Years of follow-up
Figure 3 | Analysis of association between Siglec-1 Glu88Ter and HIV-1 clinical outcomes in the absence of antiretroviral treatment. (a) Set point viral load of individuals from the SHCS with or without the Glu88Ter allele (n 2,243). (b) CD4 T-cell count dynamics of individuals from the SHCS with or
without the Glu88Ter allele (n 3,385). CD4 T-cell counts (cells mm 3) were binned using 500 days windows, counting backwards from the date of
antiretroviral treatment start or loss of follow-up. Median CD4 T-cell values (lines) and interquartile ranges in each bin (shaded areas) are shown for individuals carrying no copies (n 3,305) or one copy (n 78) of the Siglec-1 Glu88Ter allele. Actual CD4 T-cell values are shown for the two Siglec-1
Glu88Ter homozygotes. (c) Plasma viral RNA level (cp ml 1) and CD4 T-cell count (cells mm 3) dynamics of the two Siglec-1 Glu88Ter homozygotes. The dates of rst HIV-1 positive report and of ART initiation are depicted. Open circles indicate negative values bellow the represented detection level. (d)
Time to AIDS measured in the SHCS cohort (n 2,458 common allele Glu88; n 53 Glu88Ter including 52 heterozygous and 1 homozygous individuals) or
(e) the MACS cohort (n 401 common allele Glu88; n 12 Glu88Ter which were all heterozygous).
of Siglec-1 in humans impacts early viral kinetics. If that is the case, current antiretroviral treatments implemented early after infection could include Siglec-1 blocking agents to tackle multiple infectious routes simultaneously and limit the settlement of viral reservoirs. Importantly, the identication of SIGLEC1 null individuals in natura indicates that Siglec-1 could represent a safe therapeutic target.
The analysis of loss-of-function variants serves to illuminate in vivo mechanisms of disease. Recent whole-genome and -exome sequencing initiatives indicate that protein truncating alleles can be identied in a large proportion of human genes. We have estimated that up to 85% of all human genes can be observed carrying heterozygous variants17. There is strong evidence that heterozygous loss-of-function in innate immunity genes is not
NATURE COMMUNICATIONS | 7:12412 | DOI: 10.1038/ncomms12412 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 5
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms12412
Statistical analysis. Statistics of VLP functional assays were performed using unpaired and paired t test (considered signicant at Pr0.05) or the Spearman correlation with GraphPad Prism v.5 software. Set point viral load was calculated as the average of at least three measurements obtained during the chronic phase of infection (minimum 6 months after infection and before the initiation of anti-retroviral therapy (ART)). A comparison of variance in set point viral load between genotype groups showed no signicant differences (F test P 0.18). Association
between viral RNA level and genotype was tested using linear regression. Rate of disease progression was measured using all available CD4 T-cell counts beginning at enrolment or estimated date of infection (if known) before the initiation of anti-HIV therapy. The impact of genotype on disease progression was tested using the Cox proportional hazards models.
Data availability. The clinical and genetic data that support the ndings of this study are available on request from the corresponding authors; these dataare not publicly available due to information that could compromise research participant privacy. The authors declare that all other data supporting the ndings of this study are available within the article or from the corresponding authors upon request.
compensated in the majority of cases16. Thus, the discovery and characterization of human protein truncating variants serves as a general model for the analysis of other human genes involved in pathogen containment.
Methods
Patients. The Swiss HIV Cohort Study is an ongoing observational longitudinal study enroling HIV-1-infected individuals since 1988 in Switzerland. Demographic, route of transmission, clinical and laboratory data are systematically collected, and plasma and cells are stored longitudinally every 612 months. To date, 419,000 patients have been enroled. At least 50% of all HIV-1-infected, 72%
of all AIDS cases in Switzerland are enroled23. The MACS24 is an ongoing prospective study of the natural and treated histories of HIV-1 infection in homosexual and bisexual men conducted by sites located in Baltimore, Chicago, Pittsburgh and Los Angeles. A total of 6,972 men have been enroled. Clinical characteristics of the Glu88Ter homozygous include a female diagnosed in 1987 that died in 2003 of Pneumocystis jirovecii infection and refused treatment. The last CD4 T-cell count was 8 cells mm 3 and the last viremia recorded for this individual was 4750,000 cp ml 1. In 1994, she had an episode of pulmonary tuberculosis. The second Glu88Ter homozygous is a male that was diagnosed
HIV in 1987 and registered in the SHCS in 1996, when he initiated antiretroviral
treatment while clinically asymptomatic. He has been on antiretroviral treatment for most of the past 20 years (except for a short period in 2003 and 2004), with stable CD4 T-cell count between 400 and 600 cells mm 3. Last clinical values (recorded in October 2015) were a CD4 T-cell count of 602 cells mm 3 (23%)
and a viremia o20 cp ml 1.
Ethics statement. The institutional review board on biomedical research from Hospital Germans Trias i Pujol approved this study. Participants of the Swiss HIV Cohort Study and the multicenter AIDS Cohort Study (MACS) consented to the cohort study and genetic analyses, as approved by the corresponding local Ethics Committees.
Primary cell culture. Frozen peripheral blood mononuclear cells were obtained from HIV-1 patients of the Swiss HIV Cohort Study. Monocyte populations were isolated using CD14 magnetic beads (Miltenyi Biotec) and cultured 24 h with 1,000 U ml 1 of IFNa (Sigma) in RPM1 with 10% of heat-inactivated fetal bovine serum (Invitrogen).
Siglec-1 surface expression analysis by FACS. IFNa-activated monocytes were blocked with 1 mg ml 1 of human IgG (Baxter, Hyland Immuno) and stained with 1/10 dilution of a-Siglec-1-PE 7239 mAb (AbD Serotec) following manufactures instructions at 4 C for 20 min. Samples were analyzed with FACSCalibur (Becton-Dickinson) using CellQuest software to evaluate collected data. The mean number of Siglec-1 Ab binding sites per cell was obtained with a Quantibrite kit (Becton-Dickinson) as previously described5.
VLP capture and HIV-1 trans-infection assays. VLPHIV-Gag-eGFP and HIV-1NL4-3
were obtained by calcium phosphate transfection of previously described plasmids5. IFNa-activated monocytes (2 105) were pre-incubated at 16 C for
30 min with 10 mg ml 1 of a-Siglec-1 mAb (7239, AbSerotec) or IgG1 isotype control mAb (107.3, BD Bioscience). Capture experiments were performed pulsing monocytes with 150 ng of VLPHIV-Gag-eGFP Gag for 3 h at 37 C. After extensive
washing, monocytes were acquired by FACS. Trans-infection assays were performed pulsing monocytes with 300 ng of HIV-1NL4-3 for 4 h at 37 C. After
extensive washing, monocytes were co-cultured in duplicate at a ratio of 1:1 with the TZM-bl CD4 target cell line. Cells were assayed for luciferase activity 48 h later (BrightGlo Luciferase System; Promega) in a Fluoroskan Ascent FL luminometer (Thermo Labsystems).
Genetic analyses. For 392 participants from the SHCS, we captured and sequenced all coding exons using the Illumina Truseq 65 Mb enrichment kit and the Illumina HiSeq2000. Sequences were aligned to the human reference genome version 19 (GRCh 37) using BWA. Variant calling was performed using the HaplotypeCaller module of the Genome Analysis Toolkit version 3.11. Only variants passing the variant quality score recalibration thresholds were maintained for further analysis. Genotype data for 2,212 individuals were obtained using the Illumina Innium Human Exome BeadChip. Direct genotyping for rs150358287G4T in 1,129 individuals from the SHCS and 425 individuals from the MACS was performed by Taqman allelic discrimination using a custom design assay from Applied Biosystems (AHKAY5K). Exome sequencing results were conrmed by PCR and direct sequencing (forward primer: 50 AGGACGTGCAGG
GTGTGAAG330; reverse primer: 50 GCTGGAACAGAGGCTGAGAC 30; annealing temperature: 62 C; expected fragment: 455 bp).
References
1. Cameron, P. U. et al. Dendritic cells exposed to human immunodeciency virus type-1 transmit a vigorous cytopathic infection to CD4 T cells. Science 257,
383387 (1992).2. Geijtenbeek, T. B. et al. DC-SIGN, a dendritic cell-specic HIV-1-binding protein that enhances trans-infection of T cells. Cell 100, 587597 (2000).
3. Izquierdo-Useros, N. et al. Sialyllactose in viral membrane gangliosides is a novel molecular recognition pattern for mature dendritic cell capture of HIV-1. PLoS Biol. 10, e1001315 (2012).
4. Puryear, W. B., Yu, X., Ramirez, N. P., Reinhard, B. M. & Gummuluru, S. HIV-1 incorporation of host-cell-derived glycosphingolipid GM3 allows for capture by mature dendritic cells. Proc. Natl Acad. Sci. USA 109, 74757480 (2012).
5. Izquierdo-Useros, N. et al. Siglec-1 is a novel dendritic cell receptor that mediates HIV-1 trans-infection through recognition of viral membrane gangliosides. PLoS Biol. 10, e1001448 (2012).
6. Puryear, W. B. et al. Interferon-inducible mechanism of dendritic cell-mediated HIV-1 dissemination is dependent on Siglec-1/CD169. PLoS Pathog. 9, e1003291 (2013).
7. McDonald, D. et al. Recruitment of HIV and its receptors to dendritic cellT cell junctions. Science 300, 12951297 (2003).
8. Brenchley, J. M. et al. Microbial translocation is a cause of systemic immune activation in chronic HIV infection. Nat. Med. 12, 13651371 (2006).
9. Rempel, H., Calosing, C., Sun, B. & Pulliam, L. Sialoadhesin expressed on IFN-induced monocytes binds HIV-1 and enhances infectivity. PLoS ONE 3, e1967 (2008).
10. Turville, S. G. et al. Diversity of receptors binding HIV on dendritic cell subsets. Nat. Immunol. 3, 975983 (2002).
11. Izquierdo-Useros, N. et al. Maturation of blood-derived dendritic cells enhances human immunodeciency virus type 1 capture and transmission.J. Virol. 81, 75597570 (2007).12. Sewald, X. et al. Retroviruses use CD169-mediated trans-infection of permissive lymphocytes to establish infection. Science 350, 563567 (2015).
13. Quintana-Murci, L., Alcas, A., Abel, L. & Casanova, J. L. Immunologyin natura: clinical, epidemiological and evolutionary genetics of infectious diseases. Nat. Immunol. 8, 11651171 (2007).
14. MacArthur, D. G. et al. A systematic survey of loss-of-function variants in human protein-coding genes. Science 335, 823828 (2012).
15. Sulem, P. et al. Identication of a large set of rare complete human knockouts. Nat. Genet. 47, 448452 (2015).
16. Lim, E. T. et al. Distribution and medical impact of loss-of-function variants in the Finnish founder population. PLoS Genet. 10, e1004494 (2014).
17. Bartha, I. et al. The characteristics of heterozygous protein truncating variants in the human genome. PLoS Comput. Biol. 11, e1004647 (2015).
18. Rausell, A. et al. Analysis of stop-gain and frameshift variants in human innate immunity genes. PLoS Comput. Biol. 10, e1003757 (2014).
19. Rivas, M. A. et al. Human genomics. Effect of predicted protein-truncating genetic variants on the human transcriptome. Science 348, 666669 (2015).
20. Dean, M. et al. Genetic restriction of HIV-1 infection and progressionto AIDS by a deletion allele of the CKR5 structural gene. Hemophilia Growth and Development Study, Multicenter AIDS Cohort Study, Multicenter Hemophilia Cohort Study, San Francisco City Cohort, ALIVE Study. Science 273, 18561862 (1996).
21. Jungreis, I. et al. Evidence of abundant stop codon readthrough in Drosophila and other metazoa. Genome Res. 21, 20962113 (2011).
6 NATURE COMMUNICATIONS | 7:12412 | DOI: 10.1038/ncomms12412 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms12412 ARTICLE
22. McLaren, P. J. et al. Polymorphisms of large effect explain the majority of the host genetic contribution to variation of HIV-1 virus load. Proc. Natl Acad. Sci. USA 112, 1465814663 (2015).
23. Schoeni-Affolter, F. et al. Cohort prole: the Swiss HIV Cohort study. Int. J. Epidemiol. 39, 11791189 (2010).
24. Phair, J. et al. Acquired immune deciency syndrome occurring within 5 years of infection with human immunodeciency virus type-1: the Multicenter AIDS Cohort Study. J. Acquir. Immune. Dec. Syndr. 5, 490496 (1992).
Acknowledgements
We thank the patients for participating in the SHCS and MACS. We thank Nimisha Chaturvedi and Victor Urrea for their excellent statistical assistance. The members of the SHCS are Aubert V., Battegay M., Bernasconi E., Bni J., Braun D.L., Bucher H.C., Burton-Jeangros C., Calmy A., Cavassini M., Dollenmaier G., Egger M., Elzi L., Fehr J., Fellay J., Furrer H. (Chairman of the Clinical and Laboratory Committee), Fux C.A., Gorgievski M., Gnthard H. (President of the SHCS), Haerry D. (deputy of Positive Council), Hasse B., Hirsch H.H., Hoffmann M., Hsli I., Kahlert C., Kaiser L., Keiser O., Klimkait T., Kouyos R., Kovari H., Ledergerber B., Martinetti G., Martinez de Tejada B., Marzolini C., Metzner K., Mller N., Nadal D., Nicca D., Pantaleo G., Rauch A. (Chairman of the Scientic Board), Regenass S., Rudin C. (Chairman of the Mother & Child Sub-study), Schni-Affolter F. (Head of Data Centre), Schmid P., Speck R., Stckle M., Tarr P., Trkola A., Vernazza P., Weber R., Yerly S. MACS Principal Investigators are: Johns Hopkins University Bloomberg School of Public Health (Joseph Margolick), U01-AI35042; Northwestern University (Steven Wolinsky), U01-AI35039; University of California, Los Angeles (Roger Detels), U01-AI35040; University of Pittsburgh (Charles Rinaldo), U01-AI35041; the Center for Analysis and Management of MACS, Johns Hopkins University Bloomberg School of Public Health (Lisa Jacobson), UM1-AI35043. J.M.-P. and N.I.-U. are supported by the Spanish Secretariat of Science and Innovation through Grant SAF2013-49042-R. N.I.-U. is supported by the Gilead Fellowship Program GLD1400271 and the Mathilde Krim Fellowship in basic biomedical research 108676 founded by AmfAR AIDS research Foundation. JMP is supported by the Spanish AIDS network Red Temtica Cooperativa de Investigacin en SIDA. Work at the laboratory of A.T. was nanced by the Swiss National Science Foundation. The genetic analyses were realized within the framework of the Swiss HIV Cohort Study (SHCS Project number 717), which is supported by the Swiss National Science Foundation (Grant Number 148522) and by the SHCS research foundation. Some data in this manuscript were collected by the Multicenter AIDS Cohort Study (MACS). The MACS is funded primarily by the National Institute of Allergy and Infectious Diseases (NIAID), U01-AI35042, U01-AI35039, U01-AI35040,
U01-AI35041 and UM1-AI35043, with additional co-funding from the National Cancer Institute (NCI). This project has been funded in part with federal funds from the Frederick National Laboratory for Cancer Research, under Contract No. HHSN261200800001E. This Research was supported in part by the Intramural Research Program of the NIH, Frederick National Lab, Center for Cancer Research.
Author contributions
Conceived and designed the experiments: J.M.-P., P.J.M., N.I.-U., A.T. Performed the experiments: I.E., M.P.M., S.B., M.R. Analyzed and interpreted the data: J.M.-P., P.J.M.,I.E., M.M., S.B., M.R., J.D., D.O., S.M.W., S.P., H.F.G., J.F., M.C., N.I.-U., A.T. Wrote the paper: J.M.-P., P.J.M., N.I.-U., A.T. The contents of this publication are solely the responsibility of the authors and do not represent the ofcial views of the National Institutes of Health (NIH). The content of this publication does not necessarily reect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. Government.
Additional information
Competing nancial interests: The authors declare no competing nancial interests.
Reprints and permission information is available online at http://npg.nature.com/reprintsandpermissions/
Web End =http://npg.nature.com/ http://npg.nature.com/reprintsandpermissions/
Web End =reprintsandpermissions/
How to cite this article: Martinez-Picado, J. et al. Identication of Siglec-1 null individuals infected with HIV-1. Nat. Commun. 7:12412 doi: 10.1038/ncomms12412 (2016).
This work is licensed under a Creative Commons Attribution 4.0 International License. The images or other third party material in this article are included in the articles Creative Commons license, unless indicated otherwise in the credit line; if the material is not included under the Creative Commons license, users will need to obtain permission from the license holder to reproduce the material. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
Web End =http://creativecommons.org/licenses/by/4.0/
r The Author(s) 2016
NATURE COMMUNICATIONS | 7:12412 | DOI: 10.1038/ncomms12412 | http://www.nature.com/naturecommunications
Web End =www.nature.com/naturecommunications 7
Solicitou a tradução automática realizada por máquina do conteúdo selecionado das nossas bases de dados. Esta funcionalidade é oferecida apenas para a sua conveniência e não pretende, de maneira nenhuma, substituir a tradução humana. Mostrar aviso legal
A ProQuest ou os seus licenciadores não fazem representações ou garantias a respeito das traduções. As traduções são geradas automaticamente "NO ESTADO EM QUE SE ENCONTRAM" e "CONFORME DISPONÍVEL" e não são mantidas nos nossos sistemas. A PROQUEST E OS SEUS LICENCIADORES ESPECIFICAMENTE RENUNCIAM A TODAS AS GARANTIAS, EXPRESSAS OU IMPLÍCITAS, INCLUINDO, SEM LIMITAÇÃO QUALQUER GARANTIA DE DISPONIBILIDADE, PRECISÃO, PONTUALIDADE, INTEGRIDADE, NÃO INFRINGIMENTO, COMERCIABILIDADE OU ADEQUABILIDADE A UMA FINALIDADE ESPECÍFICA. A utilização das traduções encontra-se sujeita a todas as restrições de utilização contidas no Acordo de Licença de Produtos Eletrónicos e ao utilizar a funcionalidade de tradução, está a concordar em abdicar toda e qualquer reclamação contra a ProQuest ou contra os seus licenciadores pela utilização da funcionalidade de tradução e qualquer resultado derivado dela. Ocultar aviso legal
Copyright Nature Publishing Group Aug 2016
Resumo
Siglec-1/CD169 is a myeloid-cell surface receptor critical for HIV-1 capture and infection of bystander target cells. To dissect the role of SIGLEC1 in natura, we scan a large population genetic database and identify a loss-of-function variant (Glu88Ter) that is found in ∼1% of healthy people. Exome analysis and direct genotyping of 4,233 HIV-1-infected individuals reveals two Glu88Ter homozygous and 97 heterozygous subjects, allowing the analysis of ex vivo and in vivo consequences of SIGLEC1 loss-of-function. Cells from these individuals are functionally null or haploinsufficient for Siglec-1 activity in HIV-1 capture and trans-infection ex vivo. However, Siglec-1 protein truncation does not have a measurable impact on HIV-1 acquisition or AIDS outcomes in vivo. This result contrasts with the known in vitro functional role of Siglec-1 in HIV-1 trans-infection. Thus, it provides evidence that the classical HIV-1 infectious routes may compensate for the lack of Siglec-1 in fuelling HIV-1 dissemination within infected individuals.
Solicitou a tradução automática realizada por máquina do conteúdo selecionado das nossas bases de dados. Esta funcionalidade é oferecida apenas para a sua conveniência e não pretende, de maneira nenhuma, substituir a tradução humana. Mostrar aviso legal
A ProQuest ou os seus licenciadores não fazem representações ou garantias a respeito das traduções. As traduções são geradas automaticamente "NO ESTADO EM QUE SE ENCONTRAM" e "CONFORME DISPONÍVEL" e não são mantidas nos nossos sistemas. A PROQUEST E OS SEUS LICENCIADORES ESPECIFICAMENTE RENUNCIAM A TODAS AS GARANTIAS, EXPRESSAS OU IMPLÍCITAS, INCLUINDO, SEM LIMITAÇÃO QUALQUER GARANTIA DE DISPONIBILIDADE, PRECISÃO, PONTUALIDADE, INTEGRIDADE, NÃO INFRINGIMENTO, COMERCIABILIDADE OU ADEQUABILIDADE A UMA FINALIDADE ESPECÍFICA. A utilização das traduções encontra-se sujeita a todas as restrições de utilização contidas no Acordo de Licença de Produtos Eletrónicos e ao utilizar a funcionalidade de tradução, está a concordar em abdicar toda e qualquer reclamação contra a ProQuest ou contra os seus licenciadores pela utilização da funcionalidade de tradução e qualquer resultado derivado dela. Ocultar aviso legal